Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0502
Clone ID AX0502
Vector pGT0lxr
Project sanger

Sequence tag AX0502
Sequence
AATGACTATACAGTGATGGCATAAAATACAAGTAGCTTTAACACTGCTCTTATGAAAGATTATTTAATAATGGAAAAGAT
TTATAATGTCTAAGTGAAAAAAATATTTCAGAACAGTGCTTAGAATGTGCTAACAGTCTTGTAAAGTTATGAGAACCCTA
GTTAGTATTCATTAGTGCCAATTGTTCACCACACTACACTGCACACTGCAACCCTAGAAGATCACCTGAGCATAGTCAGA
CTATGAAAGCTGGAGAAAAGGAGAAAGGACTGCATGAAAGTTGCTTCCATGGAACGTCAAGAGTACTGAGAAATGTGACT
GTCTTCTCTTGGTCCTCAGGTCCCAATGCCATTTCTGTAAGCCTGTCCCCGATGGGCCGATACGTTATGGTGGGCTTGGC
CTCACGAAGGATCCTACTGCACCCCTCCACAGAGCACATGGTAGCCCAGGTCTTCAGGCTGCAACAGGCCCATGGTGGTG
AGACTTCCATGAGG
Sequence Type mRNA
Unitrap ID UNI3504

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91726642..91727135 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es