Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11873G7
Clone ID IST11873G7
Vector VICTR76
Project tigm

Sequence tag IST11873G7BBF1
Sequence
GGGGGGTCACTACAACATGAGGAACTGTATTAAACATTAGGAAGGTTGANAGCCACTGAACTGGACTTTCTATTTCTATT
TCTTTTTTTTTAACTTTTTTTAAAAGAGTTATTTATTTATTTTATGTATATGAGTACNCNGNANCTAGCTGTACNNATGG
TTGTAAGCCTTCATGTGGTTGTTGGGAATTGAATTTTANGACCTCNGCTCNCTCNTTCCCTGNTNNNTNNTACCNAAAAA
TTTATTTATTATTATAAATAANTACACAGTANCTGTCTTCNNACAGCACTAGAANAGGGTGTCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11873G7HMF1
Sequence
GGGGGGTCACTACAACATGAGGAACTGTATTAAACATTANGAAGGTTGAGAGCCACTGAACTGGACTTTCTATTTCTATT
TCTTTTTTTTTAACTTTTTTTAAAAGAGTTATTTATTTATTTTATGTATATGAGTACNCTGTANCTAGCTGTACNNATGG
TTGTAANCCTTCC
Sequence Type genomic DNA
Unitrap ID UNI31727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51257729..51257900 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078750 (AC105966.11)  

 
Come back to gene ENSMUSG00000078750


For any suggestions or comments, please send an email to unitrap@crg.es