Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13027G1
Clone ID IST13027G1
Vector VICTR76
Project tigm

Sequence tag IST13027G1HMF1
Sequence
GTATGAGTGTGCTGAGAATCAACTGGCNNCAGAGGTCCTCCCCTGGGTTGGCNGTCCCTTTCTGACTANGTGGAACACAC
TTGCCCTGATTCTGGGAGGCACATCTGGCAAGCACTCAAGCCTAAAGAGAAGAAGAGAAACGTAGGAGGAAGTCCAGAGC
ACAGTAGCTTAGCCCTTTGTCCATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI36771

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34365199..34365386 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es