Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426541
Clone ID OST426541
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426541
Sequence
CGAGAGCCCACCCCTAGCACCCCGGAGAATGAAGAGTGGAGCAGAAGCCAGCTGGGAAAACCAAGAAGGGGGATCTTGGA
CTGGTTCAGAGCAAGGACCAAATGAGGAGCGGTGGAGACAGACTCAGGAGCTGGAATCAACCGGACTGGAGGGTTCTGCG
GAGTAGAGCGACATACAGGCCACTGCCAGGTTCCTAGCTGGATGAATGGATAGGCATGCCACTGTTTGCAATAAACAACC
TCCTAAAGGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 162775221..162780901 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035576 (L3mbtl) NM_001081338 l(3)mbt-like (Drosophila) Gene [Source:MGI (curated);Acc:L3mbtl-001]

 
Come back to gene ENSMUSG00000035576


For any suggestions or comments, please send an email to unitrap@crg.es