Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13136D6
Clone ID IST13136D6
Vector VICTR74
Project tigm

Sequence tag IST13136D6HMF1
Sequence
GTAGGCTGCCAGGCNAGCCGGGGATACGGGCCCGCACCCCGCTCCTCTGCTGGGCTGCGGGGACTTGGGCGCCGCCGAGC
ACGAGCAGCCCGCTCGCGGCCAGTCCCCGGCCGCANCTTCCGGGGGGTGGGGGACN
Sequence Type genomic DNA
Unitrap ID UNI35722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35362438..35362572 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021798 (Ldb3) NM_001039076 LIM domain binding 3 Gene [Source:MGI Symbol;Acc:MGI:1344412]

 
Come back to gene ENSMUSG00000021798


For any suggestions or comments, please send an email to unitrap@crg.es