Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10055H2
Clone ID IST10055H2
Vector VICTR75
Project tigm

Sequence tag IST10055H2HMF1
Sequence
TTAGAAACCATCTTAGGATGTCATTTAAGAAAGATAAATGTGGGACACAAAGGCTCACCTTTTGTAATTTGACTTTGTAA
ATTGTAAAGGTGGCTTTTGTAATCTGAGTTTCTATTAGAAGTATGCCAGTCTTTTTAACTTATCAGTCAATTAAAAAAAA
AGTTGTTTCAAAAAAGAATTTCGTATTTTTAATGCTACTCATGTTCCAACGAAGAATACTTCTAAGCAGCCTGGAAAGAT
ATACCACAGTATGACAACATAATAACTTATAGTAGGTATCTCAGCAAGTCCTCCCTTGTGCTTCCAGCCACACTAAACAT
TGTTTTCCTTTTTGATACTTACCTGGGGAACTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129111919..129112273 353
 
EST/CDNA Est Name
  BE848448.1 - BX512025.1 - AI317267.1 - CA870413.1 - BB864613.1 - BY150890.1 - CD539262.1 - AI256686.1


Sequence tag IST10055H2BBR1
Sequence
TTAGCATGTGTTTAGTTTTATCATTTTTAAAAGTGAGCCATTGCTATGAATTTTTAAATATATTTTTCTCTTTATGTTTT
CAGACTCCTGGACCTAAAAAAGATGTTTCCAATCATGTTTTGCCTAGCAAAACTACAAGACCCATCAACATTAAATTCCA
GACTAAACCAGCCAGTATCACAGCATCCCAGAAGCCAGAGTCCAAGCCACCAAAACTTCCAAGCAGAGGACTCACGTCAA
GATGTTTTTCTTCTAACACAGACTGTAAACAGTCCAGCAAGCCTCAACATCAACCTAGAGCAGTGTCATTCACTGCAGGA
CTGTCAAGAAACCCCAGGCCGTGCCCTGATATACAGGAACTAAAAACCAAACAGCAACAGCAAGCACATGGAGGAAATGC
TAAATGTACACATCCCGAGACTAACACCCACGCTGAAAAGCACCTTGTGGATGGCTCTCCAGATGAAACAAACTAAGTAT
ACTTGCCCCTGGCCCTGCCCAAAACCTGAAAAGCCAGAATCCTGGAGTCACATTCTATTAGAAAA
Sequence Type genomic DNA
Unitrap ID UNI4691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 129111379..129111920 495
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048327 (Ckap2l) NM_181589 cytoskeleton associated protein 2-like Gene [Source:MGI (curated);Acc:Ckap2l-001]

 
Come back to gene ENSMUSG00000048327


For any suggestions or comments, please send an email to unitrap@crg.es