Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12483F9
Clone ID IST12483F9
Vector VICTR76
Project tigm

Sequence tag IST12483F9BBF1
Sequence
GAACCCTATCCGGCTGACCTGAGTGCTGTGATGACAGGCACATCACCACCATGGCTGACTACATGATGGACTTTCATCAC
TAGCAATTGTCTCTGTCTCTCTTCATACAGCCCAAGCTGGTCTCAAACTTGCTATGTGCCTGGGGCTGGCCTTGAACTCT
TGAAGTCTTCCTGCTTCTATCTCACAACTGTTGGTATTACACATGGGAGCCACTATGCCCAGCTCCAGAGTCTGTTTTCT
CTCTGATCACCTCTGAGACTCTAATAGGATGCTTAAGAACTGCTTGGTTAGAAGTCCTGGAAACTTACTAGCTGAGAGAC
TGTAGCAGGCTCCACGAGCTTTTTTCCTATCTAAATGGAACGAGTGCAAATAACATTTTCCATTGGAAAGACTGAAGGAA
ATGAAATGAGTGCAGGCATCTATTTACCACAGANGANGACNAAGANCCTGCCTGGTTGTCTCTTTCTTGATCTGTCTCCT
TTANTCTTTTCCNGANNACTGTTTCCTCCTGTCTCTTTTCCTTTGTTNNAGANTACNTTTGAGGGNNGGGGANNNGACTC
NNCNCTTTN
Sequence Type genomic DNA
Unitrap ID UNI13159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22417325..22417893 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es