Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12376D12
Clone ID IST12376D12
Vector VICTR76
Project tigm

Sequence tag IST12376D12BBF1
Sequence
TTGGGAGCGGGGACCTGCTTCTATGCCTGGCTCAACAGTGTGCGCCTTGAGCATCATTATCGTGCGTGTTGCCCTGAATG
TTCCATGCTTGAAGAAGCTGGTCTGTGTAGCACAGCGAGGCTCACACACAGCTCAACAGGGTTCCCATCCTGAATCTGCT
ACCTTCCATGACCCCCTCAGAAGCCTCCACCTTACTTTTCTTTCAGGGATTCAAAGACCAGAATGCTCATTTGGCTGAGG
AGGGGGCAGGTCAGAAGTCTCCCGCTCATCTGTTAGGAGCGGGTTTTGGTGTGGCATCTTCGTTTCTTGGGCTCTGGATT
TTGGGCATGGAGTACGTTTCATCTCCTGTAATCTGTTCACTCCAGATATGTGGTGTCTAGGTTGTCGCAAAGCTCATTGT
CTTTTTTCCTGAAATGCTCCCTGGTCGGCTGTCTTGCTTCCCAAGTGGGTTAGTTATAGTGCCACTGTTGGCTGCTGGAA
CCCAAAAGCTCTACCNACTGAAGANGCTTTTTGCCTTGCAATNNTNAGATACCCGGNCATGGGCATAGCTCCCTAAN
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104148704..104149258 543
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST12376D12HMF1
Sequence
GTGGGAGCGGGGACCTGCTTCTATGCCTGGCTCAACAGTGTGCGCCTTGAGCATCATTATCGTGCGTGTTGCCCTGAATG
TTCCATGCTTGAAGAAGCTGGTCTGTGTAGCACAGCGAGGCTCACACACAGCTCAACAGGGTTCCCATCCTGAATCTGCT
ACCTTCA
Sequence Type genomic DNA
Unitrap ID UNI30826

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104148703..104148868 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es