Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST426446
Clone ID OST426446
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST426446
Sequence
TGAGATGAAGAGCTGGAAGACAACCCCAACCAGAGCGACTTGATCGAACAGGCAGCTGAGATGCTTTATGGGTTGATCCA
CGCCCGCTACATCCTCACCAACCGAGGCATCGCACAAATGTTGGAAAAGTACCAGCAGGGAGACTTTGGCTACTGTCCTC
GTGTATACTGTGAGAACCAGCCAATGCTTCCTATCGGCCTTTCAGACATCCCAGGCGAGGCCATGGTGAAACTCTACTGC
CCCAAGTGCATGGACGTGTACACACCCAAGTCCTCCAGACACCACCACACGGACGGCGCATACTTCGGCACTGGTTTCCC
TCACATGCTCTTCATGGTGCATCCAGAGTACCGGCCCAAGCGACCTGCCAACCAGTTTGTACCCAGGCTCTATGGTTTCA
AGATCCATCCAATGGCTTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCAGTCAAGACTATTCGCTGATTG
CCCACCCACCTCTCCCTCTGTCTGTGACACCC
Sequence Type mRNA
Unitrap ID UNI8797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35253246..35255521 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024387 (Csnk2b) NM_009975 casein kinase 2, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88548]

 
Come back to gene ENSMUSG00000024387


For any suggestions or comments, please send an email to unitrap@crg.es