Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15108A5
Clone ID IST15108A5
Vector VICTR80
Project tigm

Sequence tag IST15108A5BBF1
Sequence
NANAACTTTCTTCTCTTTACTGATAATATTCCAATGTATGCATTTATTGTACTTAATCTGTTGGTGGATGCGCATTATTT
CTACTTANTAGTAATTGTGAATAATGCTATGTGCATATATATGTGCACAATTATCTGATTGTATCCACTTTCAGTCCTTT
TATTAATGTACTTAGAAGAGGAACTAGTGAATCACATGTAAACTTTATGTTTAAAACATTTCAAACTTATTTCTATAACA
TTGCCCCATCCTGCCTGTAATGCATAATGGTTTCAACTTCTCCCAACCAATTCCAATCAACGTTTATTTTCCTTTGTTTG
CAGTCATGGTGGTAGTGGGAGGAGCACTGGCCTCACAAGTTTGTGTAATGAATTGATCTGTCTTTTTCTAGTGACCAACG
ATATCACTAATTCTTGTGGGTTTTGGCCNTCNGNTAANCNTCTTTGGANATATATAGTTCCTTCTNNNNANNTCCNTTGT
TCATATGTNAAATGGGTTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172479..27172973 465
 
EST/CDNA Est Name
  DV071379.1 - DV070897.1 - BB235640.2 - BB824455.1 - BB823975.1 - BB553292.2 - CK637852.1 - BB822584.1 - CN676469.1 - BE572793.1 - BG294155.1 - BY723018.1 - CF161221.1 - CF159211.1 - CF157580.1 - AA874045.1 - CF742134.1 - BM876038.1


Sequence tag IST15108A5HMF1
Sequence
GCAGAACTTTCTTCTCTTTACTGATAATATTCCAATGTATGCATTTATTGTACTTAATCTGTTGGTGGATGCGCATTATT
TCTACTTAGTAGTAATTGTGAATAATGCTATGTGCATATATATGTGCACAATTATCTGATTGTATCCACTTTCAGTCCTT
TTATTAATGTACTTAGAAGAGGAACTAGTGAATCACATGTAAACTTTATGTTTAAAACATTTCAAACTTATTTCTATAAC
ATTGCCCCATCCTGCCTGTAATGCATAATGGTTTCAACTTCTCCCAACCAATTCCAATCAACGTTTATTTTCCTTTGTTT
GCAGTCATGGTGGTAGTGGGAGGAGCACTGGCCTCACAAGTTTGTGTAATGAATTGATCTGTCTTTTTCTAGTGACCAAC
GATATCACTAATTCTTGTGGGTTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172475..27172901 427
 
EST/CDNA Est Name
  DV071379.1 - BB824455.1 - BB823975.1 - BB822584.1 - CN676469.1 - BY723018.1 - CF161221.1 - CF159211.1 - CF157580.1 - AA874045.1 - BM876038.1


Sequence tag IST15108A5HMR1
Sequence
CTGCAGAAGTGCTGTAATATGGGCAAATCATCAACGTAACTGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172433..27172478 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es