Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13043H6
Clone ID IST13043H6
Vector VICTR76
Project tigm

Sequence tag IST13043H6HMR1
Sequence
CTGTAGTTTTAATTCCNAACTTACCTCTAACCTTGATTCCTGATTTGAGTTCCTACTCATGGGCTCTTAATTCCCCACCT
TAACAGCAACCCCTAATTTGACTCAAGCATTTTAAAGAAATCTTTAATCCCAGCACTCAAGAGGCAGAAGCAGGTGGATC
TCTGTGAGTTGAGGGCCAGCCTCATCTACAAAGGGAGTCCCAGGGCTACAGAGGAAGAAAGCTCTTATCCACCCTTAATT
CTTCANAGCTCTGGGTGTCATCTGCTGCCATCTGCTCATCTTTACCATCTGCCCCAAAGCCTTTGCTCAAGTCCCTTTCC
TGTGTCTCTANAANAGCTTCCTTAGTTCCCACCCCTGCCTGTCTNATCNNACCTTTCCAGCGGGGAGAGCGGGCTCTTTA
CCTGCTGGCCCANTGTGCCGTGCCCAGTCTTCTTTTGTGACAGANNGANGCAGAGCTGTGGAAGTCNGANGGCTNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136440088..136440561 448
 
EST/CDNA Est Name
  CJ175650.1


Sequence tag IST13043H6BBF1
Sequence
CAGGTATCACTGTGTGATTAAAAGTACGATAATTTAAGATTCAGGAGTTGAGGGGTGGAACTCAGGTGGTTGACTGACTG
CTTATCAAGAACAAGCCCAAGCAGGGCAGTGGTGTCGCACGCCTTTAATCCCAACGCTTGAGAGGCAGAGGCAGAGGCAG
GTGATCTCTGAGTTTGAGGCCAGCCTGATCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAAACCCTGTCTCAA
AAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI36567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 136439840..136440090 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029699 (Srcrb4d) scavenger receptor cysteine rich domain containing, group B (4 domains) Gene [Source:MGI (curated);Acc:Srcrb4d-002]

 
Come back to gene ENSMUSG00000029699


For any suggestions or comments, please send an email to unitrap@crg.es