Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14789A9
Clone ID IST14789A9
Vector VICTR76
Project tigm

Sequence tag IST14789A9HMR1
Sequence
TGCCNGTANGGAAGGTGGCNNAATTTANTACAAACACAATGGAAAGGCTCTTGTCATTCCAGGCACTANCANATGTCACA
CAGGGCCNGGATATAGACCTCTGAGGTGTCAGTGTCAAGACTTTGTATGCCANAATCTCCCATGCCTGAACCAAATGAAA
AGTTGAACCATGATGGCTTGAGAGCANAGTCTCCAATGTCACTTTGTGTGGTANTCCTGCTGTCTACACCCTGGCTCTCC
GGTGTCCATAAATACCTTGCAAGCACTCTGTTCCGAGCTCATCCTAAAACCCGGAGGGCCGCTGCTCACACACACATGGC
ANANAGTANCTGANTTTCTGGAANCNNCACACCANNCCNNNCNNACCTGGTCACAATGGGGCCTGGCGCTGACTTGTGCA
GCTTACANAAAACGCTGCATTGNTGCACTANNTGGCAGANANAAATANAAATGTANNANAGAACACTCCNNNACTCAAGG
AGCTGTGAGAGAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14789A9BBF2
Sequence
GGGGCAGGTCAGCTTCAGCTGCAAAGCTACTGAGAATAAAGATAGGCAAACCTCTTAATAATGAACAGGAACCCTAAACA
TCCCTGAAAACCAAGTCTTGTCGCCTCAGAAACTCTTCCCCCCCACTGCCTCAAGAGGAACCAAGAAAGGACAGGACTGG
TCCCCTGCATCCCATCACCCCAACTCCAGCTTCTTAGCCCCCTGCTCCTTCTGGTTAAGGGCAGTGGTCACACACTCACC
ATGTTGCCAAGTTGTAGATCGCTGGCAATTCCCTAAGGCTCCTGGCAGCAGAGATCAAAACAAATCAGACCAATCATTCA
GCCGGCTCCCAAAGGAGAGCACAGAGCGCAGAGAAACATGCCACACGGAAGAACACGCCTCTACTTCTATTGGCGGGCCT
AAACAGANGCCTTGATTGGCAAGTGAATCTTGATTGACGTGATCACCTCCCTTANGTTAGAGTGCTCTGTAGACATACAG
CATTGGGCTTCCAGCTGCGNGTTTCTTATCCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 61941188..61941699 497
 
EST/CDNA Est Name
  CN460115.1 - AV311056.2 - CJ066699.1


Sequence tag IST14789A9HMF3
Sequence
AATAAACCTTAAAAACTAGAGTTTTGTTTTGTTGTTGTTGTTGTTGTTTTAAAGAAAAGATTGGAATAGGGCTGACAAGA
TGGCTCAGTGGGCAAACATGATTTCTACCAAGGCTAACGACCTTAAGTCAATCCCTGAGACCCACATAGTGGGAGGAAAG
AGTCGCTTCCTATACATTCTCCTCTGGCTCCATACGTGAGGCCTGGCACTTGGGTCCCCCTCCCCCATCAGTAAAATGGA
AAAAAAAAGTTGGAATTGTATAAGTGGGAAAAACTANCCTGTAAATTCTCTTCATGTGANAAAACACATCTAGCATGATT
GCCTTCTTGGGCTTCCCTCGTANCTTCCTGCAAGGAACACANACACAGGAAGGAGACCCAAGCCCTGCTGCCCCCGCTAG
CCCTGGGGTGCAGTGTGTTA
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135165452..135165870 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es