Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14908E7
Clone ID IST14908E7
Vector VICTR76
Project tigm

Sequence tag IST14908E7HMR1
Sequence
CTTTACCTGAAGCAAGACCTTCACACACTGTGGCTGACAGGAGATGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96483576..96483623 48
NO GENE  


Sequence tag IST14908E7BBF1
Sequence
AAGGCAGTCCGTTGGTGCTCCTGTGCAGGCTANAAAGAAATGCANCGTGTTCCCAACTTTGTTTTGTANTAACCNNCAAT
ATTGTCTCATTCCANATANCGCAGCTGATTGTCACTTATCANCNNGCTCACNAACATTTNNTTANCATCTACTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14908E7HMF1
Sequence
AAGGCAGTCCGTTGGTGCTCCTGTGCAGGCTAGAAAGAAATGCAGCGTGTTCCCAACTTTGTTTTGTAGTAACCAACAAT
ATTGTCTCATTCCAAATAGCGCAGCTGATTGTCACTTATCAACATGCTCACGAACATTTGTTTAGCATCTACTCTGTACT
TGTACCATGCTTGATGCTGTCTGTCTCTGGGGGGCAGGCCAGAAAGCAGGGTACCCAAGGACAACTGAGTTCGGCCAGTA
NTAGAN
Sequence Type genomic DNA
Unitrap ID UNI20190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96483621..96483865 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es