Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11943H2
Clone ID IST11943H2
Vector VICTR76
Project tigm

Sequence tag IST11943H2BBF1
Sequence
GAGGCAGGCGGATTTCTGAGTTCGAGGCCNGCCTGGTCTACAGAGTGCTGGGAANNANGGTGTGCNCCACCNNGCTTGNC
NTGAACTCTTTATCTTCTAACCTCCGTGTTCTGAGTACTANGACTTCGGGTATCGGCNAACNTGCTCTGTTGTTATGTAG
TGTTANGGGCCAAATCCAGGGTCTCAAACATGCCNNTCNAGCCTCTACCCACTAANCTACGTCCCATCCGCAGGCTCTCT
GCATTTTAATAAGTGCTACAGGGTTTTCTAATGTGACTCCCTCAAAATGACTATNNNAATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11943H2HMF2
Sequence
GAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAAC
CCTGTCTC
Sequence Type genomic DNA
Unitrap ID UNI14153 UNI29063 UNI32421 UNI32422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6189838..6189925 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10881714..10881801 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4633460..4633547 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3696597..3696684 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12363591..12363678 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8605179..8605266 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058570 (AC129222.4-202) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3TZ95]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8118202..8118289 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4533096..4533183 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4756134..4756221 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9974624..9974711 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024287 (Thoc1) NM_153552 THO complex 1 Gene [Source:MGI Symbol;Acc:MGI:1919668]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3537285..3537372 88
 
EST/CDNA Est Name
  CD553020.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 10225995..10226082 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 24972444..24972531 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10681688..10681775 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5702414..5702501 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 16642494..16642581 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3536728..3536815 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12914353..12914440 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14098749..14098836 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032009 (Sesn3) NM_030261 sestrin 3 Gene [Source:MGI (curated);Acc:Sesn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7865551..7865638 88
NO GENE  

 
Come back to gene ENSMUSG00000032009


For any suggestions or comments, please send an email to unitrap@crg.es