Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14520D10
Clone ID IST14520D10
Vector VICTR74
Project tigm

Sequence tag IST14520D10BBF1
Sequence
TTTATTCTCTTGGAAGANACATTATAAATTTTTCCCTCTTTTTTTCCNGTGCAGAACACATCTACAAACATACCAAACAC
ACATGCACACGCACAGGAAGAAAGAAACTGAATGAGATGCTAGAGGATCAATTCTATGTAAATGAAAATAGCTAGCACCC
ACTGACATTTTAAAGTCAAGCTATATAGCAAACTTAAGGCNNGCCTGAATTACATGAGAATCTGTCTCAGANNACAGGAA
AAAAATCTACACTTTTCAGGTTAACATTTTANATTTTATTCTTTTTCCTTTTGGGTGGTGTATTTTANCAAGCATTCTAC
AACTCAGCTACATCCCCAATCCTTCTAAAGCCTTAACTTTANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8410245..8410610 348
 
EST/CDNA Est Name
  BG082035.2 - CF911628.1 - AA537068.1 - AA139240.1 - CN687159.1 - BG090610.1 - AA435318.1


Sequence tag IST14520D10HMF1
Sequence
TTTATTCTCTTGGAANANACATTATAAATTTTTCCCTCTTTTTTTCCAGTGCANAACACATCTACAAACATACCAAACAC
ACATGCACACGCACAGGAAGAAAGAAACTGAATGAGATGCTAGAGGATCAATTCTATGTAAATGAAAATAGCTAGCACCC
ACTGACATTTTAAAGTCAAGCTATATAGCAAACTTAAGGCCANCCTGAATTACATGANAATCTGTCTCANAAAACAGGAA
AAAAATCTACACTTTTCAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8410245..8410505 249
 
EST/CDNA Est Name
  AA139240.1 - CN687159.1 - BG090610.1 - AA435318.1


Sequence tag IST14520D10HMR1
Sequence
TGAGACTATATAAACAAAATTTTCTACTTTTAAGTGTTTCTCCTTTCTAACCTTTTCTCTGATGAAGTACTATAATTATT
TGGG
Sequence Type genomic DNA
Unitrap ID UNI23798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8410119..8410202 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002297 (Dbf4) NM_013726 DBF4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351328]

 
Come back to gene ENSMUSG00000002297


For any suggestions or comments, please send an email to unitrap@crg.es