Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14809F10
Clone ID IST14809F10
Vector VICTR76
Project tigm

Sequence tag IST14809F10HMR1
Sequence
GCCGTTGAGGTCTGGGACGCTGGGTCCATTCTGGATAGTGATTCCCTTATCCTTGATTTCCTGGTATGCTGTCTCTTCTC
CTTCTTGAGCCCTGGGTGGCTCCCCCTCCTGCTGCTGCTGCTGCGAATGCATGGCCTCTGTGTATTGCCTCCGAAGCTGC
TCAAGCTCTGCCCGTAAGGATTCATACAAGACCAGGGGGACGACCTCGGCCTGACTTTCTTCTGCCATCTGCGCCTCATC
CTTTTCAAACTCCTCAAGGATCTGGGGGTGGGGAGGCAGGCAGGCTAAGAGGTGGNCTCACCATGTTCCCTGCCNACCCC
NAGGTCTGCNNANATNTCCNCTGCCTCNNTTTCCCCACCTGGACCTTTTCCNNCNNCNNNNGGTTCNGCCTGGTGAGCNG
NNCNANCTGCTNNTGTNNNGNNNCAANNATTTCNTNTGCTNATGGACTCNGGTTCNNNGNCNNNANTGCATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14809F10HMF1
Sequence
GGCACCACATATGCAGAAACCAAAGCAAATGGAATGGAACTCCAAGCAGGAGGCTCCAAGGGTGTCTGGAATACTGAAGC
AGGGGTTTCAGAAGCAGCACCCATAGAACCCGAGGCTGCAGGTTCAGAGGCCACGGGGAAAGACAGACTGGCAGCCAAGG
AAATGGACACTAGTGCTACTATGGCTGAGGCCCTAAATGTGAAAGCTCTAGGTGACAATGCCGAAAGTGAGCCAGTGGCT
GCCGAAGATACAGGAGGAAAAGAGAATCCAGGAATGAAAGCTGATGAGGTGGATGTGTTGGCACAGGCAGGGCTCACAGG
TACAGTGATTAGAAACATGGAGGCCATCGGAGTGCGGGATACAGGAATTCAGGCCACAGGATTANAGGCTAANGCAGTGA
AGANCACTGGAGTGCAGGCCACAGTGNCGGANGTCATANGAGTGAANNCACAGGANTGCANACCACAGCGATAGAANCTA
TAGGANTCANGGACACCACCCN
Sequence Type genomic DNA
Unitrap ID UNI30832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81105520..81106021 472
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]

 
Come back to gene ENSMUSG00000054708


For any suggestions or comments, please send an email to unitrap@crg.es