Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0136
Clone ID AB0136
Vector pGT0lxr
Project sanger

Sequence tag AB0136
Sequence
GATTTTCCCGGGGGCGGTTATAAAACCTTTACCCGGGGGGATGAGTTGAATTTTTTTTTTTTTTTTCCCTTGCCGCCATA
TTTGAGTTCCGGGTAGCTGGAGGGAGGAGAGTTGTGCTTGAGCTTTCCCGGGTGCCTGTTCTGCCGACTGCCGCTCAGTA
GGAAGAACGCCTGGATG
Sequence Type mRNA
Unitrap ID UNI3513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33102747..33102856 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053600 (Zfp472) NP_694703 zinc finger protein 472 Gene [Source:MGI (curated);Acc:Zfp472-001]

 
Come back to gene ENSMUSG00000053600


For any suggestions or comments, please send an email to unitrap@crg.es