Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424G7
Clone ID IST14424G7
Vector VICTR74
Project tigm

Sequence tag IST14424G7BBF1
Sequence
CACACAGGTCTTTGTTTGCTTTTTTTGTTTTTATTTTTTTTTCTCCGTGGTGCCNTGTACACTAGGCAAGCTCTCTATAA
TCCANTTATATCTCTAGGCCAACAACTTTACATTTGAAATGTGTTTGTCTATGAAAACTCAAGGGATAGTAATATCTGCC
CTCTCACCACAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15109886..15110061 168
 
EST/CDNA Est Name
  BG404026.1 - AA103680.1


Sequence tag IST14424G7HMR1
Sequence
TGAATATANGGTCCTATGTGACTGAATGAACTATTTGCAAAGCTGTNAAGCCAGCCTTGTGCTTGAACCCTACTAGTCTA
GTATATCGTAAAAGTGTGGTATATCATAAGTACCTAATAATTANCAATATATTGTGTGCNATATATTTGGAAGAGAGAAG
TCCCCTCTANGTGGAAGATGGGCACTTCNCCNGGTGCTGCNNGN
Sequence Type genomic DNA
Unitrap ID UNI22706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 15109670..15109869 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031938 (4931406C07Rik) NM_133732 RIKEN cDNA 4931406C07 gene Gene [Source:MGI Symbol;Acc:MGI:1918234]

 
Come back to gene ENSMUSG00000031938


For any suggestions or comments, please send an email to unitrap@crg.es