Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14502A3
Clone ID IST14502A3
Vector VICTR74
Project tigm

Sequence tag IST14502A3HMR1
Sequence
GTATTTAAGCTGCATCCAGTAATGCTGGACTGATGAGTTTGAAGACCNGGATAGAGACATAATTAGTTATAGAAAGGTGT
CTTGCTTCACAGATAGACTGGCACAAGAAATGCAATGGTTGAACATGCTGCGTGATGGGTTTTTCTTTCTTTCCTATTTT
TTTCTTTGAGACAGGGTTTCTCTGTGTANCCTTGGCTGTCCTGGAATTCACTCTATACACCGGGATGGCTTTGAACTCAA
ANNTCTCCCTGCCTCTGCCTCCCANGTGCTGGGATTAAACATATGTGCCNNCATCATCTGACNNTTTATCTTATTTTAAG
TTTATGGGCATTGTCNTTTTGCCTGTATGTATGTTNGNNNGNGTGANNGNANTGNATCCNNNGNNNCTGNNNTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14502A3HMF1
Sequence
AGTGGTCTTGGTTCCTGTTAGTAGGATTCCTCCGTTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTT
C
Sequence Type genomic DNA
Unitrap ID UNI15268 UNI31928

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9231513..9231592 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32542125..32542204 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 96487958..96488037 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6435963..6436042 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 11327899..11327978 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55228930..55229009 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 59703679..59703758 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24734024..24734103 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 80802369..80802448 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15828213..15828292 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12395526..12395605 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7621023..7621102 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18117987..18118066 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 68328814..68328893 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078690 (D0Kist4) DNA segment, KIST 4 DNA Segment [Source:MGI Symbol;Acc:MGI:108437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 92913773..92913852 80
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 45564..45643 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079194 (AC133103.5-209) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UT50]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 38307560..38307639 80
NO GENE  

 
Come back to gene ENSMUSG00000079194


For any suggestions or comments, please send an email to unitrap@crg.es