Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14796C6
Clone ID IST14796C6
Vector VICTR76
Project tigm

Sequence tag IST14796C6HMF1
Sequence
TCTGAATAGCAAAGCAAAATCTCTCAAGATTAAGTTTAAAACTAAATTTAAAAACTGAACACAGGGCTGTTGGTATAGCT
CAGTGGTAACGTACCTGCCTAGGATGTATGAGGCCTTGGGTTAGATCACTAAGACTGTAAAAACAAAACACTACCAAAAA
ATTAAATACAAATAAGCATACAATATGAACTCAACTAATTGACATACTGAAGTAATATAGGCAAAAAAAAAAAAAAAAAA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35523038..35523277 240
NO GENE  


Sequence tag IST14796C6BBF1
Sequence
TCTGAATAGCAAAGCAAAATCTCTCAAGATTAAGTTTAAAACTAAATTTAAAAACTGAACACAGGGCTGTTGGTATAGCT
CAGTGGTAACGTACCTGCCTAGGATGTATGAGGCCTTGGGTTAGATCACTAAGACTGTAAAAACAAAACACTACCAAAAA
ATTAAATACAAATAAGCATACAATATGAACTCAACTAATTGACATACTGAAGTAATATAGGCAAAAAAAAAAAAAAAAAA
AAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35523036..35523277 242
NO GENE  


Sequence tag IST14796C6HMR1
Sequence
CAGAGAGCTTGTACTTGACCTGATTTTGAAATAATTTACCTGGCCTAAAGTAAATCAGGTCATGGAAAACAAGTTGGCAG
CAGACCTATTTGCTGCTGTATTGATGGACACNATATTATAGTGTCAGGAAAATTAAGGAAATGACTGCTGATTTGTTTAA
ACTTAAAAAGCTACNTATGGGATTGCACACACTTTAAGTATATGTTGTGAGCAAAACGTTCTTGTAATANTAGCTGTCAT
CTTCTATTCCCTGAGGAGGCTTANATGCTCCCTACTATCACATGAGGAGTTAGGATTCCCGAAAACTAAATTCTCCAAGG
GATTTTTATGTANATTATCTTCCACACNCCCTANGANAGAAGTGGGTGTGANTGGATGTANAAAATCTTCTCANCANTTG
TANANTGNTGTCC
Sequence Type genomic DNA
Unitrap ID UNI4014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35523274..35523685 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es