Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111C9
Clone ID IST10111C9
Vector VICTR76
Project tigm

Sequence tag IST10111C9BBF1
Sequence
AGACAACTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAAAGAGAGAGAGAGAGAGAGAGAAGTGGATGA
CTGAGTTCACAGAGAAGGTCACTGAGGTCGCTGGGGACAGGAGCCCAGGGGTCTGGTGTGACAGGAAAGAGCACTGTCAT
TGAGCTGTACCCCAGCGCTATCATGTTAGGCATAAAATACTTTTATTCACTCAGTGTGTGTTTGTGTGTGCACACAGGGC
AGGACATATGGAGAACAGAGGACACCAGTGGGAGTCGTTTGTCTCCTCCAACCCAAGACTGAACCCAAGTCATTTTGCTT
GGTGACTAGCACCTTTATCTGATAAGCCACCTCACTGGCCACTTCTTCATTTTGGGGGCCATGTAGCCCAGGCTAGCTTC
AAACTTTTTCTGTAAGTAGCTAACGCTAGGCTTTGTCCTAGCCTTCACCTCCATGGTGTTGGAATACTGAGCCTGCACTA
TCCAGGCTGCATTTTTGTTTTTGTTATATTTTACACTCTTATTATAGAAATAGAGTCTCCACAAGTTGCCCAGTTAGCCT
TCAGCTCACTCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20410404..20410976 557
NO GENE  


Sequence tag IST10111C9HMF1
Sequence
AGACAACTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI909 UNI9679 UNI36780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 53769403..53769453 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 21522135..21522185 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61439476..61439526 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17916493..17916543 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 58273459..58273509 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28034020..28034070 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55765666..55765716 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35132111..35132161 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4870710..4870760 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5931317..5931367 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20940867..20940917 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87724463..87724513 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11290962..11291012 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30389275..30389325 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025747 (Tyms) NM_021288 thymidylate synthase Gene [Source:MGI (curated);Acc:Tyms-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4411749..4411799 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17318539..17318589 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72889244..72889294 51
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21238853..21238903 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 164610160..164610210 51
NO GENE  

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es