Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10087B3
Clone ID IST10087B3
Vector VICTR75
Project tigm

Sequence tag IST10087B3BBF1
Sequence
TTGCCTACCACTATTTCTAAAATAACGAGTTTATGGGGTTTGATTTTACTTCTGTGATTGGCTCTGAAGGCTGAAGCCAG
CCTCGTTTAGGCTGCTCACCTGGAGTGCTTGTAGATGACAAAGGCAGCTAAAAAAAAAAAAATGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75132781..75132924 144
NO GENE  


Sequence tag IST10087B3BBR1
Sequence
GCAATTTACAATGTTAACATTCTTTAACTTGGTAAACATTTGTATAAGGGGTGAAGGGCAAATACACACTCCGACAGGGT
GGCGCGTCTTATTTGCTGCTTGGAAGCGTGCTCGGTCCCCCTCCTTTTTATCTACCTGTTGCCTTGACCCAGCTGCTTCT
GAACTCTGTTCTAATCTCTCCCTGCTGTGACAGTTCACTAACGCTTCACGGTACCAGAGACTCTTTCAACTCATATTTTC
CACCAGCTGTCAGTTGCAAAATAAGGTTGCTTTGTTTGGGGGAAAGGGTAGAACCCTTTGTAAACGTCTCCTTTTCCTTT
GAAGCCAAAGCACTTGAGAGACAATTGAACTGCTTTTAGGTTTTCCTTACCACCCTGCTTTCTCTTCTAATGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI18441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75132387..75132784 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000751 (Rpa1) NM_026653 replication protein A1 Gene [Source:MGI (curated);Acc:Rpa1-001]

 
Come back to gene ENSMUSG00000000751


For any suggestions or comments, please send an email to unitrap@crg.es