Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935C3
Clone ID IST14935C3
Vector VICTR76
Project tigm

Sequence tag IST14935C3BBF1
Sequence
CTATCTCCTGTATTTCTTTAAGGGAGTTATTTATGTCCTTCTTAAAGTCCTCTATCGTGGGCGTGGTAATGCATGCCTTT
AATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATCTCTGAGTTCGAGGCCAGCCTCGTCTACAAAGTGAGTTCCAGGAC
Sequence Type genomic DNA
Unitrap ID UNI36783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59248356..59248513 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009894 (1110031B06Rik) NM_144521 RIKEN cDNA 1110031B06 gene Gene [Source:MGI Symbol;Acc:MGI:1915076]

 
Come back to gene ENSMUSG00000009894


For any suggestions or comments, please send an email to unitrap@crg.es