Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13036D12
Clone ID IST13036D12
Vector VICTR76
Project tigm

Sequence tag IST13036D12HMF1
Sequence
AGTTCAAGGTCNTATCCAGCTACATAGTAAATCTAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63833486..63833522 35
NO GENE  


Sequence tag IST13036D12HMR1
Sequence
ACTTTGTTCCCGTGGCCGACCTCCTAAGTGCTGGAGTNATCCTTGCATGTTAGCAATGCTCCATTCCTTGGTCCTCCCCC
ACCCCATCTTCTTTCTTTTCTTGTAGTTCCTGACTAACGTGGACCATTTAGAAAGTAAGAAAAGCCTAGGGGGAACCCAC
TCACCCGGGGGAACCCACCCACCCTCAGCTCTTGTTCCCTGAGAGCAAGTAGTCCTGTTGTTAGAATCATTTGGAATATT
TTTTTCTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI17237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63833238..63833488 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036867 (Smad6) NM_008542 MAD homolog 6 (Drosophila) Gene [Source:MGI (curated);Acc:Smad6-001]

 
Come back to gene ENSMUSG00000036867


For any suggestions or comments, please send an email to unitrap@crg.es