Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12964D4
Clone ID IST12964D4
Vector VICTR76
Project tigm

Sequence tag IST12964D4HMF1
Sequence
CAACCTCTCCCTCCCATGCTCAGCCTCCAGCCCATAGGCAGGATGTGTCCTCTCCATGGGTGGAAGGAAGCCTGTGTACC
TATAAAGTGATGCCCTGGGCCTTCCACCTCCCTCCTGGCCCCGTCTCTCCTCCCACTGANATCCTAGGCTTAGGCTCCAA
CCCATGAGGCTGTCTGGTGTCCCGGTGAGTGAGCCTCCGATAGCCCCANACCTCATGCCCAGTGCNTTCTGATTTCCAGC
TCTGGCAGCCACACCCTGACTGGTGACAAGGGTGAGTGAANACNCANGCNNNCTCCTGCTTTGGCTCTTTTGGGGTTNCT
CCAGGCTGCTCTGTCNTCANACAACTGCTCTCTGCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI10859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 137325729..137326087 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028766 (Alpl) NM_007431 alkaline phosphatase, liver/bone/kidney Gene [Source:MGI (curated);Acc:Alpl-001]


Sequence tag IST12964D4BBF2
Sequence
GTGGCACATAAAGCAGTTGGCATCCTGGCTCCCTGGGAAGCTCANAAGGTTTGCTGGGGCCATTGAGGGTGGGGAGGGGT
CTTCAGTTTTTGTCCTCGTTAGGGTTTTATGGCCGAGAANAGACNTCNTGACCACN
Sequence Type genomic DNA
Unitrap ID UNI19923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61393564..61393698 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]

 
Come back to gene ENSMUSG00000058806


For any suggestions or comments, please send an email to unitrap@crg.es