Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14978A5
Clone ID IST14978A5
Vector VICTR76
Project tigm

Sequence tag IST14978A5BBF1
Sequence
GACTTCCTGGTGGAGGTGAGTAGGACCAGTCCTGGGAAGTCTGACAGATGCCTGGTGCTTAACAAGCCCATGGAATTTGA
ACCCACAAATGGGAAGGTAGGCTTTATTTGTCCGTCTCACCAGTTCCTGAGGATACACACTCACATGCAGCTTTCAGCTT
GGACAACCTACAAGTGGAGGGACTGCTGAAGCCCTCCCAGTCCCATCACAGCAAGGGAGATAGAGCTGGATGGGTGCATT
TGANAGCTACGATGGTTGTCAAGGAGACATAGGGATAAGTATGGAGTTGGGTGGAGTGAGTTGAAGGGGACATTATATGT
CNGGGCNNGTGATAATCACACTNCTNNCAAACATN
Sequence Type genomic DNA
Unitrap ID UNI32805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33719367..33719720 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]


Sequence tag IST14978A5HMF1
Sequence
GACTTCCTGGTGGAGGTGAGTAGGACCAGTCCTGGGAAGTCTGACAGATGCCTGGTGCTTAACAAGCCCATGGAATTTGA
ACCCACAAATGGGAAGGTAGGCTTTATTTGTCCGTCTCACCAGTTCCTGAGGATACACACTCACATGCAGCTTTCAGCTT
GGACAACCTACAAGTGGAGGGACTGCTGAAGCCCTCCCAGTCCCATCACAGCAAGGGAGATAGAGCTGGATGGGTGCATT
TGAGAGCTACGATGGTTGTCAAGGAGACATAGGGATAAGTATGGAGTTGGGTGGAGTGAGTTGAAGGGGACATTATATGT
CAGGGCCAGTGATAATCACACTACTAACAAACATATAACACTTANTGGAGCCNGATATGGTAACACACACCAGCACTCAT
GANCCTGANGCAGGAAGANTATGAATTGAAGGCCAGTTTAAGCTGCATAGAATGACCNTNNGGTTTTCCATTTATTTGTT
TGCTTATTATTTTGAGANANGANCTNCCAACCTGGAGTTTTCNATGTNANTCNNTTGCCCTCAAACATACAGACNTCGGC
CCN
Sequence Type genomic DNA
Unitrap ID UNI32805

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33719367..33719929 523
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es