Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14268C7
Clone ID IST14268C7
Vector VICTR74
Project tigm

Sequence tag IST14268C7BBF1
Sequence
AAATGTTTNNNNNNNTATAAAAAGTATCCTGCATGTTCCATGGCACACAATATAGAAACTGCTGCTTTAATTTATATTTA
AAAACAAGAAATTAATCCCAGTAATCTAAGTACTTGGGAGGCAGAAGGAGGTGGGCCTGAGCCCAGGCAATCCTAAGATC
CTCTCTCAAACCACAGCTAGGCTAGGGAGAGGGCTCACATAAGGTANCTCACAACTACCTGTAACTCCAGTTCCAGGAGA
TCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42896409..42896652 228
NO GENE  


Sequence tag IST14268C7HMF2
Sequence
CATCCACCACGCTTCCAATGAGGGAAGAGGGAAAAAATGTCCATGGCGGGATAAAGACCCTGGTCGGGCTGAAAAGTGCC
AGCAGCTACTCATTCATTCATTCATTCATTCATTCATTCATTCATTCCACGTAGTCTTAAGTCCCAGTAACTGGAACTCG
CCAACTCCGAAGCGGACTGGAACCTCTCAAGTCCCAGGAGGGAGAACTCGGTCACAGAAGGCAGGGGCCCCCGCGCACGC
ACACACACACACACACACACACACANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56443957..56444221 265
NO GENE  


Sequence tag IST14268C7HMR1
Sequence
CTATGTAGGAGGCCAGGACTACAGGAGATTGATCGTGGGAGTTGCTTCCTTTGCTCAATCCGATGTAACGGGGCGAGGGT
ACTCTACTTCCCCTCCTCCTTCCTGGCNNGCCCCNCTGACTGGAGGGGGGGGTCNCCCTCTGTCTCCCNCTCTCNCTNTN
Sequence Type genomic DNA
Unitrap ID UNI31362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56444344..56444500 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es