Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10284B7
Clone ID IST10284B7
Vector VICTR76
Project tigm

Sequence tag IST10284B7HMF1
Sequence
CAGCCACCATCAGATACTGGTTAGATTTTCAAAGATTTACTTAAAAGTTCATCTGANAAGGACGTGAACAGTTAGATATT
ATTCAGGCTGTGTGACCAGGCATGCTTTAAAACTATTAAAGAGTAAGACCTGTTCTATGTTTTTTTTTNGTTTTTNGTTT
TTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22738939..22739110 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es