Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10245B7
Clone ID IST10245B7
Vector VICTR76
Project tigm

Sequence tag IST10245B7BBF1
Sequence
CTACTGGGGTTCGGGAATCGTCTCACAAACACCAATCTCAGACAGGGATAGTTTAGTGAGCATATATTCCATGACTTGAC
CAAATTCCATGGTCCAGATTTGGGAACTGGACCATACCCCTTGAATTAAGATCCTACAGGATTTTTAGGCCCCAAATCCA
CAAACATCTGTGCCAAGTTATTCAGGATTTAGGGATGGAGGATTTCCTTGGGAACATGTCTTTGTTGTACACCACTCACT
GTGTTCCTATTGGTTGGGGTATTCAACTGTGGCAGGGGACTTGCCTTATCTAATATTCAGGTCTTAACTTGTCTACTGGG
ATGGGACTTGTCTAACATTCATGTGTCTTAACTTGCCNATTANGAGGTCAATTACGCAAGTACATGTCTCTTTGTGCNNA
GTAAACTTGACTTGACCACTACTCAAGATGGAAGTATNATTCCNAATAGTTTCTTATACTGGTACAAGTGTCTCTTTTTT
TTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI15534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119611946..119612431 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]


Sequence tag IST10245B7HMF1
Sequence
CTACTGGGGTTCGGGAATCGTCTCACAAACACCAATCTCAGACAGGGATAGTTTAGTGAGCATATATTCCATGACTTGAC
CAAATTCCATGGTCCAGATTTGGGAACTGGACCATACCCCTTGAATTAAGATCCTACAGGATTTTTAGGCCCCAAATCCA
CAAACATCTGTGCCAAGTTATTCAGGATTTAGGGATGGAGGATTTCCTTGGGAACATGTCTTTGTTGTACACCACTCACT
GTGTTCCTATTGGTTGGGGTATTCAACTGTGGCAGGGGACTTGCCTTATCTAATATTCAGGTCTTAACTTGTCTACTGGG
ATGGGACTTGTCTAACATTCAA
Sequence Type genomic DNA
Unitrap ID UNI15534

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119612091..119612431 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034032 (Rpap1) NM_177294 RNA polymerase II associated protein 1 Gene [Source:MGI (curated);Acc:Rpap1-006]

 
Come back to gene ENSMUSG00000034032


For any suggestions or comments, please send an email to unitrap@crg.es