Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425808
Clone ID OST425808
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425808
Sequence
GTTTGAGGACCCTAGGAAAATTGTTTTATGAATGGTGNCACTCGGGCCGCAGTGGTGACCTCACCACCTCCANCCACAGC
CCCTCACAAGGAGAGGTATTTTGACAGAGTCGATGAGAACAACCCAGAATATTTGCCGGGAGAGGAACATGGCACCAGAC
CTTCGTCAGGACTTCAATATGATGGAGCAGAAGAAGAGGGTGTCTATGATTCTACAGAGTCCTGTANGGAAANCTTTGTT
CAGAACAAGTTTGGCCAGCTTCCTTGNGATTNCTGCGCTCTTCGGCCTGTTGTTTGAAAGACAGTCAGTTCTCATCACTC
AGCACATCAGTGTTCATGTTTATAGAAACTTGTTGAAAAATTCTGTTTGGTTTGTGTTAGCAGACATAACTAGAAGATTT
TATAATTATAAAGGGTAGATATTAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16201

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34943971..34944389 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es