Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14944E5
Clone ID IST14944E5
Vector VICTR76
Project tigm

Sequence tag IST14944E5HMF1
Sequence
ACTGGAGGCTCATTACCAGCCCCAAATCCACATTTTATTTAAAATATTGACTCAATTTTTCCCCCAGGACATTTATTTTA
CCAAATGTAAGAAAACTAAACGCCAACATTTTTCTTTTTCATTTAAATCTTTTCATAGAATATATTTTGATCATATTCTT
TACCCTCCCCCAACTCTCCCAACCTATCTATTCACCCAACTTCACATTCTCTCTCCTTCTGTCACAGTCTCTGTTCCTGT
CTCGCTTTCCCTCTCTCCTTTCTTTGTCTCTCTTTCCAAAACAAAACAAAACAAAATAAATAAATAAATAANNTNNNACA
AACAAATCNAAAAGTGCACTGAAAAACCAAACGTCNTTTGNCNTGANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20595731..20596096 348
NO GENE  


Sequence tag IST14944E5BBF1
Sequence
ACTGGAGGCTCATTACCAGCCCCAAATCCACATTTTATTTAAAATATTGACTCAATTTTTCCCCCAGGACATTTATTTTA
CCAAATGTAAGAAAACTAAACGCCAACATTTTTCTTTTTCATTTAAATCTTTTCATAGAATATATTTTGATCATATTCTT
TACCCTCCCCCAACTCTCCCAACCTATCTATTCACCCAACTTCACATTCTCTCTCCTTCTGTCACAGTCTCTGTTCCTGT
CTCGCTTTCCCTCTCTCCTTTCTTTGTCTCTCTTTCCAAAACAAAACAAAACAAAATAAATAAATAAATAAATTCAAACA
AACAAATCAAAAAGTGCACTGAAAAACCAAACGTCATTTGTCTTGACTCAATGCTCCTGGGCATAAGCGACCCTGGANTG
TGGCTGATACACCCAGAGACACCTGGAGTGTGGCTGATACACCCAGANACACTGCGTTAGAGAAAGTCAGTTTTCCCTCT
TCNANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20595615..20596096 478
NO GENE  


Sequence tag IST14944E5HMR1
Sequence
AGTGTGACNATTTCNGAACTCCTATGCACAGGGACTCAAGCTCACCACTGGCTGTGCCTTGGGAACCAGTATGAGGTGAG
TGAAACGTGGACAGATTCTACAAATAGATTTACTGCACCAAATCCAACTAGGGATGAATATGCTTACAAGAAGCAGTGTA
GCCACGTGATGCGTCTGCACCTACGCAAGTCC
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20596094..20596284 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es