Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10458G5
Clone ID IST10458G5
Vector VICTR76
Project tigm

Sequence tag IST10458G5BBF1
Sequence
GTAGTGTATTACATTTTTACCAAACAGCACTACTGCACAACCTGACCCACTCTCCTCCCTTTCTCACAGGACTGCCTTTG
CAACTCCTGCTTTCTGGTCTCTCTACATTCAAACTGCTTTTCATGTGGCTATGCTTCAAATGCCCATTTAATTATATCCT
AGTATAACAATTTAGATACAATAAGCATTTTATCTCTAACTCTCTTTTCTAAGTATTTATATCAGTTTGCCCTTCATTTT
GTCTTCCAACTTGATAGAAATGTACTGTCNNAAATCNTTTAAACACGGATCATAACTTATTTTTATGAGAGGGGACAAAC
AGCATACCACTGTAGACCTTGTANNCCACATCATCTTTGTCAAAAAACTAATATTCNTACAATATTTACACAAACATTTT
TCTACTTGTCNCAAAATATTATTTTGNTTTTCCCACCNACTTCTGGNTATGTAAAAATATGCCTAACTTATATGTTGTGC
ACAGTCNGTATGCTATAGATGGTNNGTTTATCTACTTTGAAAGTTTTACNAGTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8411170..8411711 511
 
EST/CDNA Est Name
  CK780364.1 - CA751808.1 - BG965702.1 - DV659908.1 - CN686973.1 - BY726126.1 - BG082035.2 - CF911628.1 - AA537068.1 - AA139240.1 - CN687159.1 - BG090610.1 - AA435318.1 - CA980304.1 - CJ045664.1


Sequence tag IST10458G5HMR1
Sequence
CTTTAAAAGGGAAATAATTTATAAAAATTGTGTATAATGTTTTTCTTAAATCTTTTTATAATACAAAGCTGAGGCAGGCC
TGTTAGCCCAGCTCCTTAGGAATGTGAGGCAACCTAATGAAGGAGCTAGAGAAAGTACACAAGGAGCTGAAGGGGTCTGC
AACCCTATAGGAGGATCAATAATGTGAACTAACCNGTANCCTCCANAGCTGTGTCTCTAGTTGCATATGTAGCAGAGGAT
GGCCTAN
Sequence Type genomic DNA
Unitrap ID UNI23798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 8410871..8411116 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002297 (Dbf4) NM_013726 DBF4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351328]

 
Come back to gene ENSMUSG00000002297


For any suggestions or comments, please send an email to unitrap@crg.es