Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14514H5
Clone ID IST14514H5
Vector VICTR74
Project tigm

Sequence tag IST14514H5HMR1
Sequence
CACTGATACCAATGATGTGACTGAAATGGGCGGGGCCTTGGCACATAAGATGTTTATGTTGGTGCANCANGCCCTGAGTA
CCCGTGTCCCTGGTGTGGAGGGAAGAGGGTGAGACTGGAGGGTGAGATTGGAGGGAAAGTGCTGGGCNNTGGTGNTNCNN
GCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14514H5BBF1
Sequence
NGTGAGAGTTGTACCTCTGCCTTNNCGNNTCCATTTCCCTCGCTCAACTCTTGCCCNTCTNNACACCATTCGAAAGATGA
ANAATGACTTCCGGAAAATGGAAGATGANATGGACCGGCTGGCCNNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14514H5HMF1
Sequence
AGTGAGAGTTGTACCTCTGCCTTAGTCGTTTCCATTTCCCTCGCTCAACTCTTGCCCATCTAGACACCATTCGAAAGATG
AAGAATGACTTCCGGAAGATGGAAGATGAGATGGACCGGCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI36791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6071646..6071771 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024797 (1110014N23Rik) NM_001081041 RIKEN cDNA 1110014N23 gene Gene [Source:MGI Symbol;Acc:MGI:1915755]

 
Come back to gene ENSMUSG00000024797


For any suggestions or comments, please send an email to unitrap@crg.es