Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14832D7
Clone ID IST14832D7
Vector VICTR76
Project tigm

Sequence tag IST14832D7BBF1
Sequence
TCCCGTCCTCTACTTTCCAGTGGTTTTATTATGAAGAATTTCTACCTTTTCTATAGTCTCCTTGGTATACCGAGACTGTA
GAAAATAAGCCGGGTGGAGTCAGAAGGACCCAGCTGGAAATACATACATACATACATACATACATACATACATACATACA
TACATATCCACAGTGCTAAAACACAAATTACCACCCATCCAGCGTGGCTAGCTCATAGGCTGGTATAACCAANATCCTTC
CAACTCACCAAGCTGGANAACTCTAAGCCCGGGAACATCCAAAGTGCACCCAGCAAAGCCAAGGGGGATGAGAATAGGAG
CTTCCATTTATCCTGTGTCTACTAANTAACAGACACAAAACTACATGCTTTGTCTGCTCTTAAATCATTANCGAATTGAG
GTCNANNGACGTTGGTACGTACCTGACACANANACAAAGCGTTACTCTGAAGANTGNCNAGCAGGGNCCNGGTGACACAC
ACTTN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96477824..96478306 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es