Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14972F8
Clone ID IST14972F8
Vector VICTR76
Project tigm

Sequence tag IST14972F8HMF1
Sequence
TTCCGACCTTCACTCAAGTGTTCCGCANACACCANCACCTCGAACAGCAGACTGCCCGGCTGTGAANACTGNAANAGGTT
CNNGANNTTGGGACGCACCNANGANGGANATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14972F8HMR1
Sequence
NANNANNGANNNGNCAAATGGCATTACAACGAGCAATCCCTGCACGAAGCCCTCTTTGGGGATGANNCNNGACTGGCAGA
CCGACTGCTCTCCCTGGTCATCCACCCTGAGGAGGAAGTTCAGATCCAGGCCTGCAAAGTCATAGTGAGCTTGCAGTGTC
CCCAGGACCTGGGATCCCGACCCTCTTCCTGCCGACCTANCCATTCCTGCTTTAAAACCGGGAAGTGAAGTTAAGGAGAT
CCAATAAATGCGTACGGGAGGGAAGCTCGAGGCCTCCGGAAGCAAGCGTCTGTCCGTTGCCTCCCAGGACCTGGGTGGAG
GTGCTGTTCATCANGGCCTCCCCCTAC
Sequence Type genomic DNA
Unitrap ID UNI36793

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28675650..28675981 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024223 (4930511I11Rik) NM_026290 RIKEN cDNA 4930511I11 gene Gene [Source:MGI Symbol;Acc:MGI:1914895]

 
Come back to gene ENSMUSG00000024223


For any suggestions or comments, please send an email to unitrap@crg.es