Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425670
Clone ID OST425670
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425670
Sequence
GAACCGTGACGGGCACTTAACAACTCCTCGGGTTCTCCAGTTCAAGCTGACGTGTACTTCCCACGACTGATAGTTCCATT
NNGTGGGCACATTAAAGGTGGCATGAGACCAGGCAAGAAGGTATTATGTGATGGGCATCGTAGATCTCAACCCCGAAAGC
TTTGCCATCAGCCTTGACCTGTGGAGACTCTGAAGATCCTCCTGCCGATGTGGCAATTGAACTCAAAGCTGTGTTCACAG
ACCGGCAGCTGCTCAGAAACTCTTGTATCTCAGGAGAAAGAGGCGAGGAGCAGTCGGCAATCCCTTACTTTCCATTCATC
CCAGACCAGCCGTTCAGGGTGGAGATTCTTTGCGAGCACCCACGTTTCAGAGTGTTTGTGGATGGACACCAACTTTTTGA
TTTTTATCACCGTATTCAAACATTATNTGCAATTGACACCATAAAGATCAATGGGGACCTCCAGATCACCAAACTTGGCT
GATGTTTAAAGCACTTCTATTTCAAATATGATCGATCAGGTGCCACAACTACATGTCTGAA
Sequence Type mRNA
Unitrap ID UNI18324

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20726316..20730342 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042363 (1110067D22Rik) NM_173752 RIKEN cDNA 1110067D22 gene Gene [Source:MGI Symbol;Acc:MGI:1916114]

 
Come back to gene ENSMUSG00000042363


For any suggestions or comments, please send an email to unitrap@crg.es