Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15058F11
Clone ID IST15058F11
Vector VICTR80
Project tigm

Sequence tag IST15058F11HMR1
Sequence
GGGTGGGCAGAGACTTTCAAAGCCAGACCCAGCCNCCCTGCCAGGCACACAAAGAGCCAGCGCACTCACCGGCAGCAGCT
CGAAGCCTGTGAGCTGCGCCTGTGCCCGTCCCCGCCGCCTGGGGCACGTGCTGCAGCTCACACAGGCCGAAGCCCCCGCC
CGCTGTCCCTCCCACGGGGAGCCCGGACTCCTGGACACGCCTCTACCCGGGCACACCCGCTATGCCCAGATCGAGCCGAG
CCTGCACGCGCACCCTCCTCTCCCTTCCCTTCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7341709..7341983 273
NO GENE  


Sequence tag IST15058F11BBF1
Sequence
ACCCCCTCCCCCAACTCCGTCTGTGCCTCCCAACCCGCTTCCCTGTCTGTCACTCTGCCTGTGCCTGTCCGGGGGGAGGG
GGGATGCTGCTTCCAGCTGGGGTGACAGTGAACCCAGTGAGGAGCTCGCCCCTTTCAGCCCAGAACTTGCCCTATTACCT
TTCATACTCATTCCTCAATCTTTGATACTACTGTTTTGGGTGCAGACTGCAGCAGTTGAAAGACACTAGGGTGACCCCTG
GGGACCCACAGACCTAGCAGAAGTCAGGTTCTAGCCCAGTGGCTCTTATAGAAATTCATCTTGCGCCTGTCCGGCCTCCC
ATCCNCTTTGGCCCCCAAGGGCGCATGAAGGGGGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7341980..7342338 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024968 (Rcor2) NM_054048 REST corepressor 2 Gene [Source:MGI (curated);Acc:Rcor2-001]

 
Come back to gene ENSMUSG00000024968


For any suggestions or comments, please send an email to unitrap@crg.es