Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13760H3
Clone ID IST13760H3
Vector VICTR74
Project tigm

Sequence tag IST13760H3HMF2
Sequence
TTCCAGAGATCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGATGCCTTTCTTC
TGGTGTGTCTGAAGACAGTTACAGTGTACTCATCCATTCATAAAAATAAATAAATA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93243455..93243590 136
 
EST/CDNA Est Name
  CF163389.1


Sequence tag IST13760H3BBF1
Sequence
TTCCANANATCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI3971 UNI18880 UNI34596 UNI34597 UNI36795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31673948..31674015 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51511660..51511727 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036391 (Sec24a) NM_175255 Sec24 related gene family, member A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec24a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 56665253..56665320 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55465375..55465442 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32460768..32460835 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021900 (Btd) NM_025295 biotinidase Gene [Source:MGI Symbol;Acc:MGI:1347001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82457259..82457326 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028403 (Zdhhc21) NM_026647 zinc finger, DHHC domain containing 21 Gene [Source:MGI (curated);Acc:Zdhhc21-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93243523..93243590 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41978413..41978480 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031596 (Slc7a2) NM_007514 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 Gene [Source:MGI (curated);Acc:Slc7a2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63123738..63123805 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058444 (Map2k5) NM_011840 mitogen-activated protein kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346345]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147566451..147566518 64
NO GENE  

 
Come back to gene ENSMUSG00000058444


For any suggestions or comments, please send an email to unitrap@crg.es