Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11558A6
Clone ID IST11558A6
Vector VICTR76
Project tigm

Sequence tag IST11558A6HMF1
Sequence
GCTAGCTCAGATATCANTNNNGTGGGCAAAATCCANGGTGGAATCTCCCTCANACTTAGTAAAAGCCATTCCTTAGTAAT
AAATGGAAATGAATACATTCCTCTGCAGAAAGATGCATTAATTTTACCTCCTGTACAAGCCATGCATGCTANTATCAAAC
TTTTAAAAGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77961727..77961901 161
NO GENE  


Sequence tag IST11558A6HMR1
Sequence
TTTATAATTTTGAGCCCAGCACTCTTTGTATTGANAGGAGTTTGATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI36179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77961922..77961971 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079454 (Ick) intestinal cell kinase Gene [Source:MGI (curated);Acc:Ick-003]

 
Come back to gene ENSMUSG00000079454


For any suggestions or comments, please send an email to unitrap@crg.es