Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14913F9
Clone ID IST14913F9
Vector VICTR76
Project tigm

Sequence tag IST14913F9HMF1
Sequence
ATGGTAACTCTAATTTCTGCCCCAAATCCCTGTTATATCTGGTTTATATAGTAAAACAAAACCCATCATATTTCTACTGA
GTTTAATCATCAGTATTTAGATATGTTTGTTGTATTTTGAGAAAGAATGTGTTTCTTTTCAAGACTCTCTCAAACACAGG
TACAGCCATTAATGCTCTGCTGTCTGTTCCCTTTGCTACTAAGAACTTANAGTGTCAAATATTTGGGTTTTCTTANATAC
ATTTTCCAAATTACACTTATTTATGTGGTGTGTGTCTGTCTGTCTGTCTGTCACTGCCTTGCCCATANCATAAGTGTGGA
TGTCAAAGGATAACTTGTGANTTGCTTCTTTCCTTACANCATGANNCCATGGATNAACCTCANGTTCTNANGCTCANCAN
TGCCTTTGCCNACTGANCCTGCNGGN
Sequence Type genomic DNA
Unitrap ID UNI15375

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90915839..90916263 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es