Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061D4
Clone ID IST15061D4
Vector VICTR80
Project tigm

Sequence tag IST15061D4HMF2
Sequence
AGACGATTTACAGTACTTTTAATGCGATTAGTTTTATTAAGAGGCTCGTCTAGCCTGCCTAACGGACACAGTTCTGTTGG
TACATAGCGATACGGTCCTCAGTCACATTTTCTATCTAAAGCAGGGAATTCAGACTCCTCCGTCTTCTCTACAGGAGAAA
GAAAATCAGTTACGCGGAGAACCGGAAGTACCTTTTGCTCAAAGGAGGGCGCCTCCCCTTTAAGCGCGCACCCACGTGGG
CACTCCCACAAGCCACTGGACTCGGTTTTCTGATGGGCTGGCCCGAGTTGCACGCCGGGATCTCCGGGACGCTCCAGGCT
TCTCCAGGGCTTTGCTTGTGACAACTGTGTTTTCCGGGACCACCGCGCCGGAAGTAGCGCATAGGCTTTTGGTTNATGTC
TCCCCAGAGTAAGACCGGAGCCAGCGGGCTGGGAGGGGTGTGTACAGGCGGTGGGGTGGCTGTATGGTGTGTGTGTGTGT
GTGTGTGTGTNTCTNTNNNTCNAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28623321..28623814 490
 
EST/CDNA Est Name
  BI526769.1


Sequence tag IST15061D4BBF1
Sequence
ATTGGTAGATTTAAGTAAACATTGATATTTAACATTTTACTCTTAAAAGATTCAAGTTAGACAGTTTCTGTTATGTAACA
TGCACGTTTAATTTTTACATAAAAAGAAGATATAACTGGAATATTCTCTCTGACAATATCAATAAATTCTTTTTTTTTTT
NTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 65015988..65016150 161
NO GENE  


Sequence tag IST15061D4HMR1
Sequence
GTCTAAACGCCAAAATTTGCCNCATTTAGATTTGAAAAGTCAGACCCAGCTATGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28623267..28623324 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es