Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11533D10
Clone ID IST11533D10
Vector VICTR76
Project tigm

Sequence tag IST11533D10HMR1
Sequence
ATTTTCTTTGGTTTCNGAAATATGAATTGTTANTATTTGTATCTGAAGAGACAGTTCANAAAAGTGAAAGCATGTACAAT
TCTGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI16728

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32629096..32629184 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002996 (Hbp1) NM_177993 high mobility group box transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:894659]


Sequence tag IST11533D10BBF1
Sequence
CTATNTAAAACTCANTANANCTGGGCACAGTAGCACATGCCGACNATCCTAGCATTCAGGAGGCCGAGGCGGAGGAGTAC
AGTGATTTCAAGTGCAGCCTGGGCTACAGAGATAGATCCTTTNTNNNAAGAGAAAGAGAAAGAGAGAAAGGANAACNNAN
GCAAGCCAGCGAGAAGGAGGTCCACNTGTGTNANCCCNGNACTTGGAAGGTGGAGGCAGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11533D10HMF1
Sequence
CTATATAAAACTCAGTAGAGCTGGGCACAGTAGCACATGCCGACAATCCTAGCATTCAGGAGGCCGAGGCGGAGGAGTAC
AGTGATTTCAAGTGCAGCCTGGGCTACAGAGATAGATCCTTTCTCCGAAGAGAAAGAGAAAGAGAGAAAGGAAAACAGAA
GCAAGCCAGCGAGAAGGAGGTCCACGTGTGTAAGCCCAGCACTTGGAAGGTGGAGGCAGGAAGATCTACAAGTTCAAGGT
CATCCTTGACCACATAGTTAATTTGAGGCCNGCTTGAGCTGCACTGACACCCTGTCTCAAAAGGAAACAAAAAAGCCCCC
CACACACACACACAAAGCAAAAATTTTTAGGTNATATTTTCCCCTAAAACAAAATGGTNATGATCTTTAAAAAAGATACT
AAAAATATTGGCAGGAAAAGANGCATTTCNCTCACCANAANAGCGTGCTGTATGCTTGCTNANATNCNCTCTATGGTCTT
TTAAGCTAACTTTTATACA
Sequence Type genomic DNA
Unitrap ID UNI13419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62350923..62351421 477
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es