Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425541
Clone ID OST425541
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425541
Sequence
CCCAGAATGAGATCGTGTCCCAGGCTGATCCTGTATTCTTAGAAGCTCTGAGCTCAAGGTACCTGGGAGACTCTGGCCTG
GATGACTTCTTTCTGGACATTGATACATCTGCGGTGGAAAAGGACGTTGCACTTCCACCCCCGGAGCCGCCGCACAGCCT
CTTCTGTAGCCCAGT
Sequence Type mRNA
Unitrap ID UNI16360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28261526..28261699 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055200 (Sertad3) NM_133210 SERTA domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2180697]

 
Come back to gene ENSMUSG00000055200


For any suggestions or comments, please send an email to unitrap@crg.es