Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14648G4
Clone ID IST14648G4
Vector VICTR74
Project tigm

Sequence tag IST14648G4BBF1
Sequence
GCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGANATACACAGAGAATCCCTGTCTCGAAACAAACAAACAAACAACCC
TGAAAAATACCTCCACCTCAAGGTGGTATATCAGGCAGATCATTTATCAAGCATGTGTAAAATCCTGAGTTCCTTTCCCA
ATGAGGGAGAGCAGAAATGAGGGAGGGAGGCGGCAGAGCAGAAACTTCAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27178902..27179117 214
NO GENE  


Sequence tag IST14648G4HMR1
Sequence
AGGCTGGCCTCAAACTCAGAAATCTGCCTGCCTCTGCCTCCCAAGTGCTN
Sequence Type genomic DNA
Unitrap ID UNI12847 UNI36801 UNI36802 UNI36803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7383954..7384002 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12043841..12043889 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3186730..3186778 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4552104..4552152 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3473487..3473535 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8660872..8660920 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12016048..12016096 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3315550..3315598 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4287246..4287294 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3275184..3275232 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4422421..4422469 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5281912..5281960 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9231635..9231683 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5520171..5520219 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13427552..13427600 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028883 (Sema3a) NM_009152 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:MGI (curated);Acc:Sema3a-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3174046..3174094 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3544115..3544163 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4636456..4636504 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4662338..4662386 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 94916..94964 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079678 (AC007585.15-202)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7261021..7261069 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 237519..237567 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056673 (Jarid1d) NM_011419 jumonji, AT rich interactive domain 1D (Rbp2 like) Gene [Source:MGI Symbol;Acc:MGI:99780]

 
Come back to gene ENSMUSG00000056673


For any suggestions or comments, please send an email to unitrap@crg.es