Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14645H7
Clone ID IST14645H7
Vector VICTR74
Project tigm

Sequence tag IST14645H7HMF1
Sequence
GCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAAGTGGATTTCTGAGATCGAGGCCAGCCTGGTCTACAGTGTG
AGTTCCAGGACAGCCAGAACTATAGAGAAACCCTGTCTCAAAAAAACAAAAACGGGCTGGTGAGATGGCTCAGTGGGTAA
GAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGA
TCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAATAAATAAATCTTTAAAAAAAAAT
TNNTTGAGTGNAANCNTTAAAAAAAAAAANNCNAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168540414..168540762 339
 
EST/CDNA Est Name
  BB694983.1 - AI790840.1 - BY249094.1 - BY240030.1 - CA461298.1 - BI965894.1 - BY132067.1 - BY132111.1 - BY147401.1 - BY251633.1 - BY276211.1 - BY141253.1 - BY139680.1 - BY148321.1 - BY141112.1 - BY146134.1 - BY131443.1 - BY293759.1 - CF165289.1 - BY306611


Sequence tag IST14645H7BBF1
Sequence
GCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAAGTGGATTTCTGAGATCGAGGCCAGCCTGGTCTACAGTGTG
AGTTCCAGGACAGCCAGAACTATAGAGAAACCCTGTCTCAAAAAAACAAAAACGGGCTGGTGAGATGGCTCAGTGGGTAA
GAGCACCCGACTGCTCTTCCGAAGGTCCAGANTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGA
TCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168540414..168540657 242
 
EST/CDNA Est Name
  BY147401.1 - BY141253.1 - BY139680.1 - BY148321.1 - BY141112.1 - BY146134.1 - BY131443.1 - BY293759.1 - BY122202.1 - BY147174.1 - BY212703.1 - BY779958.1 - BY222283.1 - BY342483.1 - BY789846.1 - BY789882.1 - BY794737.1 - BY782930.1 - BB869426.1 - BY124532


Sequence tag IST14645H7HMR1
Sequence
TTGCCNCCACGCCCGGCTTGTTCTGTTTTGATAAAGACAGTGTCTTGCCTAAGCCCAGACTGGTTGTGAAAGCGCTTTGC
TCTCCTGGGTCTTGTGTGTGTGTGTGTCTATGTCTGTGTGTTACAGGAATGCGGTGCTCCTCTGTGTTGGTGCTTTGTAT
CCAATGGGCTTCCTCAGTGTGTGCATCCTTGCCATAATGAAATTGACTGGAAAACTAAAAACAGTCTNCNNNCN
Sequence Type genomic DNA
Unitrap ID UNI36806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168540191..168540415 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027546 (Atp9a) NM_015731 ATPase, class II, type 9A Gene [Source:MGI (curated);Acc:Atp9a-003]

 
Come back to gene ENSMUSG00000027546


For any suggestions or comments, please send an email to unitrap@crg.es