Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13439E8
Clone ID IST13439E8
Vector VICTR74
Project tigm

Sequence tag IST13439E8HMF1
Sequence
GGAGGACCTTACCCTGTCACAGCGTCATGGTCACACTCCCATCAATAACAGGTTCAAAGACAATAGAAAACATCTTAAAA
ATAGGGCTGGAGAGATGGCTTAAAGGTCAAGGAGCACTGGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCA
CATGGTGGCTCTCAACCTTCTGTAATGAGATCTGATGCCCTCTTCTGGGGTATCTGAANACNGCTNCNNTNNNCTCTTTT
TTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13439E8BBF1
Sequence
GGAGGACCTTACCCTGTCACAGCGTCATGGTCACACTCCCATCAATAACAGGTTCAAAGACAATAGAAAACATCTTAAAA
ATAGGGCTGGAGAGATGGCTTAAAGGTCAAGGANCACTGGCTGCTCTTCCANAGGTCCTGAGTTCAATTCCCNNCNNCCN
CNNGGTGGCNCNCANCCTTNTGTANTGANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13439E8HMR1
Sequence
CTCCATCTTGTATTCTCCCTGAGGCCNTTTTAGATTTGACTAGAATTTGTTGTTTGTAAAGCTATCCATTCTTATTCTAG
AAGCCCAAGATCAAGATACCCCTGCTCACTTATCTTGACTTCTGTTAAGCTGTCTGTCTGCTTATGTGAAACCCCCCGCC
TTCAGCTAACTGATTATCTTAGTTTCTGTTAAACTGCTTGCTTGCACAAAACACCGAGCCCTGCAGCTGCGGAGACACAA
CAGAATCTGGATTTCACCTTTAAAGGCCCCTTATCCTAACTGCTCAGCACTACACTTGTATCCCAGCTACACAAGTGTAT
TCCCAGCTAGCTGGAAAAAAAGACTTCAGTTGGCTCGAAACCACGTCTGAGGGGATCTGTGGTGGGCTCCCTTTAACAAT
CTCTTTATCAGTGTGTTTGTCGCTGTTTGTGTTTGTTTGTTTGTTTTTTTTCCGANACTTGAGTTTCTCTGTGTAACCCT
GGCTGTCCNNNNCTCACTTTGTAGACNANGCTGGCCTCAAACTCANAAATCCGCCTGCCTCNGCCTCCNGAGTGCTGGGA
TTTTNNAC
Sequence Type genomic DNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75499746..75500310 539
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es