Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10985F5
Clone ID IST10985F5
Vector VICTR76
Project tigm

Sequence tag IST10985F5BBF1
Sequence
GCTGCAGCTACTCAGGCGGGAAGGCGGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10985F5HMF2
Sequence
NCTGCNGCNNCNNNNNGCGGGNNGGNGGGATCCTAGGCCNNGTGGGGATGGGGTCAGAAGGTTAAGGACCTAGCAGAGGC
TCAGCCTCCAGTCCAGCTTAGGAAACCATGTTCTCAACTCAAGATCTCAAGTCAAAGAGCCAGACNCAGGCTCATGCTTG
TGGTCCTTGAGGGGCTGAGGCAGGAGGATACCTGTAAATCCCAAGGCCAGCCTAGGTCACAGATTGAGTTCCAGGCCAGC
CAGAACTACTTAGCNNGANCCTATNTNAAAAGAGTAAAGATTGAAAAATAAAANCCTCTCTTCCAATTTGCCATCAAATT
CTTCCCTCTAGATCCNCTTNACTNNGANNNNNNNANCTNNTATGAAGGCNNGCGCCATGCCTCAGTCCCCAGANNACNNA
GCTTCCTTCCCAGAGACTTGAGGCTCCTNNNTTNCCTCTTCCTTCCCACAGAAGANGAGCTCTTTAGCTCCAAAGTTTCT
GNCGTCTTAAATCATCCTGGCTGACACACCTCCCGCACACAGCGTTGGCTGNNNTACTGAACCNNNAGAAGNNGGGN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10985F5HMR1
Sequence
NNCATGAGCCTGNGTCTGGCTCTTTGACTTGAGATCTTGAGTTGAGAACATGGTTTCCTAAGCTGGACTGGAGGCTGAGC
CTCTGCTAGGTCCTTAACCTTCTGACCCCATCCCCACCTGGCCTAGGATCCCGCCTTCCCGCCTGAGTAGCTGCAGCTAT
CTGAGAGCGATCTGTCAGTTTCAGGGGTCACCCCTGTCCCCCTGACTGGGCAGGCCTATAGTCACAGACAGCACCTCCTG
AACTCCTGTAGGGAGCACANGANTGACNGTGGCAATTTCATGTTTCACCCTGTCTGGGCAGGGACAGGCTGANCCCTGCT
GGTTGCNCCACAGCCCTGTNNAGTGGGGGGANCCCCNNCNNNGNNGTGGN
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87336144..87336497 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es