Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14298D8
Clone ID IST14298D8
Vector VICTR74
Project tigm

Sequence tag IST14298D8BBF1
Sequence
NGGCNATGTGGTCCAAGTGCCCATGCATACCANCATCANCATGCTGGANCCCTGGGTTCNNCTGCCTACAGTATACAAAC
TGGCATTGGGGGTGGGGGTGGGGNCTGTAATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14298D8HMR1
Sequence
GCCCCAAGANAGTGCCTTAGTCNTAAGCAAGGGCCAATCACACCCACAGAAGTAAAAACCTTCAAGGAGGAAAACAGAGG
TTTGGGAAAATGTATCANAGTGAAGTTGCTGAAAACATAGGGGAGTTGGCCTTGGCTCCGGTGCCTCATTTCTAAAGATG
GAGGGACCN
Sequence Type genomic DNA
Unitrap ID UNI1821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106610305..106610472 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es