Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST425352
Clone ID OST425352
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST425352
Sequence
GACTGAGGACTTGATTATCTTTCCTGATGACTGTGAGTTCAAGCGGGTACCTCAGTGCCCCAGTGGGAGGGTCTACGTGC
TCAAGTTTAAGGCAGGGTCCAAGCGGCTCTTCTTCTGGATGCAGGAGCCCAAGACTGACCAAGATGAGGAGCACTGCCGG
AAAGTCAACGAGTGTCTGAACAACCCCCCCATGCCTGGGTCACTGGGAGCAAGTGGGAGTAGTGGCCATGAGCTTTCAGC
ACTGGGCGGTGAGGGTGGCCTGCAGAGCCTGTTGGGGAACATGAGTCACAGCCAGCTTATGCAGCTCATCGGACCAGCCG
GCCTGGGAGGACTGGGTGGACTTGGGGCCCTCACTGGGCCAGGCCTGGCCAGCTTGCTGGGGAGCAGTGGACCTCCAGCC
AGCAGCTCTTCATCCAGCTCCCGGAGCCAGTCGGCAGCCGTCACCCCATCCTCCTCCACCTCTTCCGNTCGCGCCACCCC
AGCCCCTTCTGCCCCAGCAGCTGCCTCGGCAAGTGGGCCG
Sequence Type mRNA
Unitrap ID UNI11005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 179907559..179909959 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039041 (Adrm1) NM_019822 adhesion regulating molecule 1 Gene [Source:MGI (curated);Acc:Adrm1-001]

 
Come back to gene ENSMUSG00000039041


For any suggestions or comments, please send an email to unitrap@crg.es