Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11049H12
Clone ID IST11049H12
Vector VICTR76
Project tigm

Sequence tag IST11049H12HMF1
Sequence
CCAACAATATCAACCTATCACCTCCTGCTTGCTGGCTCGGGCTGGTGGAGCAACCTGGGCCCACTGCAGGTGGGAAGAGC
TGGAGAGGAAGGAGGAGTTGTTGTAGACGTAGTTATTAACACCTGCTAATTGTGCTTGGTGCTACTTCCCCCAGAAACTA
GAAGAGGAGAGTTCATGAAGGTCCCATCCAGATGTCCCATGAACCTGATCCTTGATCCCAAAAGAGCAGGAGGTCACTGA
TCTGANAAACAGAACGGTGTGTGGCCCAGGAAGACCTGCTCTGCCGCTGAACCTGGATGACCTTGACAGGTTATCCAGCC
CTTCAGCTTAGTCTGATTCCCTGGNAAGCCTGGTCNACG

Sequence Type genomic DNA
Unitrap ID UNI31671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30912552..30912909 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049265 (Kcnk3) NM_010608 potassium channel, subfamily K, member 3 Gene [Source:MGI Symbol;Acc:MGI:1100509]

 
Come back to gene ENSMUSG00000049265


For any suggestions or comments, please send an email to unitrap@crg.es